105 - 112 Homo sapiens - Deletions Deletion length: 6 bp Does not remove any origin of replication Inside the major arc	Breakpoint flanking sequences more information in Documentation - Flanking regions
	105 5fl vs 3fl Homology length: 2 bp Deleted region 112 CATTGCGAGACGCTGGAGCC ├ 5'Breakpoint ┤ GGAGCACCCTATGTCGCAGT (...) GAGACGCTGGAGCCGGAGCA ├ 3'Breakpoint ┤ CCCTATGTCGCAGTATCTGT 5del vs 3del Homology length: 6 bp CATTGCGAGACGCTGGAGCC ├ 5'Breakpoint ┤ GGAGCACCCTATGTCGCAGT (...) GAGACGCTGGAGCCGGAGCA ├ 3'Breakpoint ┤ CCCTATGTCGCAGTATCTGT

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [53] Kolman, C.J., et al., Reduced mtDNA diversity in the Ngobe Amerinds of Panama. Genetics. 1995. 140(1): p. 275-83.

 [54] Merriwether, D.A., R.E. Ferrell, and F. Rothhammer, mtDNA D-loop 6-bp deletion found in the Chilean Aymara: not a unique marker for Chibcha-speaking Amerindians. American Journal of Human Genetics. 1995. 56(3): p. 812-3.

 [55] Santos, M. and R. Barrantes, D-loop mtDNA deletion as a unique marker of Chibchan Amerindians. American Journal of Human Genetics. 1994. 55(2): p. 413-4.

 [56] Santos, M. and R. Barrantes, Direct screening of a mitochondrial DNA deletion valuable for Amerindian evolutionary research. Human Genetics. 1994. 93(4): p. 435-6.

 [57] Santos, M., R.H. Ward, and R. Barrantes, mtDNA variation in the Chibcha Amerindian Huetar from Costa Rica. Human Biology. 1994. 66(6): p. 963-77.