Loading, please wait...

Loading, please wait.



10154 - 15945
Homo sapiens - Deletions

Deletion length: 5790 bp

Does not remove any origin of replication
Inside the major arc



Breakpoint flanking sequences
more information in Documentation - Flanking regions
10154 Deleted region 15945
AACTCAACGGCTACATAGAA 5'Breakpoint AAATCCACCCCTTACGAGTG (...) CCGGAGATGAAAACCTTTTT 3'Breakpoint CCAAGGACAAATCAGAGAAA




Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [40] Mita, S., et al., Recombination Via Flanking Direct Repeats Is a Major Cause of Large-Scale Deletions of Human Mitochondrial-DNA. Nucleic Acids Research. 1990. 18(3): p. 561-567.

 [138] Moraes, C.T., et al., Phenotype-genotype correlations in skeletal muscle of patients with mtDNA deletions. Muscle & Nerve. 1995. 3: p. S150-3.

 [161] Sobreira, C., et al., Long-term analysis of differentiation in human myoblasts repopulated with mitochondria harboring mtDNA mutations. Biochemical and Biophysical Research Communications. 1999. 266(1): p. 179-86.