Loading, please wait...

Loading, please wait.



10063 - 14598
Homo sapiens - Deletions

Deletion length: 4534 bp

Does not remove any origin of replication
Inside the major arc



Breakpoint flanking sequences
more information in Documentation - Flanking regions
10063 Deleted region 14598
ATTCAAAAAAGAGTAATAAA 5'Breakpoint CTTCGCCTTAATTTTAATAA (...) CAATACTAAACCCCCATAAA 3'Breakpoint TAGGAGAAGGCTTAGAAGAA




Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.
Present in:
KSS
Isolated mitochondrial myopathy

References

 [40] Mita, S., et al., Recombination Via Flanking Direct Repeats Is a Major Cause of Large-Scale Deletions of Human Mitochondrial-DNA. Nucleic Acids Research. 1990. 18(3): p. 561-567.

 [41] Moraes, C.T., et al., Molecular analysis of the muscle pathology associated with mitochondrial DNA deletions. Nature Genetics. 1992. 1(5): p. 359-67.